Online Inquiry
Ripk1 cDNA ORF Clone, Mouse, N-His tag
SPD-13384
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse receptor (TNFRSF)-interacting serine-threonine kinase 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | RIP |
Gene Abbr. | Ripk1 |
Gene ID | 19766 |
Full Name | receptor (TNFRSF)-interacting serine-threonine kinase 1 |
Alias | D330015H01Rik, R, RIP, RIP-1, Rinp |
Introduction | The receptor-interacting protein (RIP) family of serine-threonine kinases (RIP, RIP2, RIP3, and RIP4) are important regulators of cellular stress that trigger pro-survival and inflammatory responses through the activation of NF-κB, as well as pro-apoptotic pathways. In addition to the kinase domain, RIP contains a death domain responsible for interaction with the death domain receptor Fas and recruitment to TNF-R1 through interaction with TRADD. RIP-deficient cells show a failure in TNF-mediated NF-κB activation, making the cells more sensitive to apoptosis. RIP also interacts with TNF-receptor-associated factors (TRAFs) and can recruit IKKs to the TNF-R1 signaling complex via interaction with NEMO, leading to IκB phosphorylation and degradation. Overexpression of RIP induces both NF-κB activation and apoptosis. Caspase-8-dependent cleavage of the RIP death domain can trigger the apoptotic activity of RIP. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse receptor (TNFRSF)-interacting serine-threonine kinase 1 with N terminal His tag. |
NCBI Ref Seq | NM_009068.3 |
RefSeq ORF Size | 1971 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.