Ripk1 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Ripk1 cDNA ORF Clone, Mouse, N-His tag

Ripk1 cDNA ORF Clone, Mouse, N-His tag

SPD-13384

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse receptor (TNFRSF)-interacting serine-threonine kinase 1 with N terminal His tag.
Target Information
Species Mouse
Target Name RIP
Gene Abbr. Ripk1
Gene ID 19766
Full Name receptor (TNFRSF)-interacting serine-threonine kinase 1
Alias D330015H01Rik, R, RIP, RIP-1, Rinp
Introduction The receptor-interacting protein (RIP) family of serine-threonine kinases (RIP, RIP2, RIP3, and RIP4) are important regulators of cellular stress that trigger pro-survival and inflammatory responses through the activation of NF-κB, as well as pro-apoptotic pathways. In addition to the kinase domain, RIP contains a death domain responsible for interaction with the death domain receptor Fas and recruitment to TNF-R1 through interaction with TRADD. RIP-deficient cells show a failure in TNF-mediated NF-κB activation, making the cells more sensitive to apoptosis. RIP also interacts with TNF-receptor-associated factors (TRAFs) and can recruit IKKs to the TNF-R1 signaling complex via interaction with NEMO, leading to IκB phosphorylation and degradation. Overexpression of RIP induces both NF-κB activation and apoptosis. Caspase-8-dependent cleavage of the RIP death domain can trigger the apoptotic activity of RIP.
Product Details
Description Full length Clone DNA of Mouse receptor (TNFRSF)-interacting serine-threonine kinase 1 with N terminal His tag.
NCBI Ref Seq NM_009068.3
RefSeq ORF Size 1971 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.