RIPK1 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

RIPK1 cDNA ORF Clone, Human, C-Myc tag

RIPK1 cDNA ORF Clone, Human, C-Myc tag

SPD-13390

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human receptor (TNFRSF)-interacting serine-threonine kinase 1 with C terminal Myc tag.
Target Information
Species Human
Target Name RIP
Gene Abbr. RIPK1
Gene ID 8737
Full Name receptor interacting serine/threonine kinase 1
Alias AIEFL, IMD57, RIP, RIP-1, RIP1
Introduction The receptor-interacting protein (RIP) family of serine-threonine kinases (RIP, RIP2, RIP3, and RIP4) are important regulators of cellular stress that trigger pro-survival and inflammatory responses through the activation of NF-κB, as well as pro-apoptotic pathways. In addition to the kinase domain, RIP contains a death domain responsible for interaction with the death domain receptor Fas and recruitment to TNF-R1 through interaction with TRADD. RIP-deficient cells show a failure in TNF-mediated NF-κB activation, making the cells more sensitive to apoptosis. RIP also interacts with TNF-receptor-associated factors (TRAFs) and can recruit IKKs to the TNF-R1 signaling complex via interaction with NEMO, leading to IκB phosphorylation and degradation. Overexpression of RIP induces both NF-κB activation and apoptosis. Caspase-8-dependent cleavage of the RIP death domain can trigger the apoptotic activity of RIP.
Product Details
Description Full length Clone DNA of Human receptor (TNFRSF)-interacting serine-threonine kinase 1 with C terminal Myc tag.
NCBI Ref Seq NM_003804.3
RefSeq ORF Size 2061 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 84T/C,381C/T,910T/C not causing the amino acid variation.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 2.06kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.