Online Inquiry
RING1 Knockout Cell Line
SPL-03038
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | RING1 |
| Gene Abbr. | RING1 |
| Gene ID | 6015 |
| Full Name | ring finger protein 1 |
| Alias | RING1A, RNF1 |
| Species | Human |
| Genomic Locus | chr6:33209664 |
| Transcript | NM_002931 |
| WT Expression Level | 25.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of RING1. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTCTGAATGCAGTGACCGA |
| PCR Primer |
Forward: CTTTTCTCCATTTGCTCCAAGTCAT Reverse: CCTAACTTTGTACCCCTTCATCTCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.