RIF1 Knockout Cell Line - CD BioSciences

service-banner

RIF1 Knockout Cell Line

RIF1 Knockout Cell Line

SPL-03033

Size Price
1 Unit Online Inquiry
Description
37bp insertion
Target Information
Target Name RIF1
Gene Abbr. RIF1
Gene ID 55183
Full Name replication timing regulatory factor 1
Species Human
Genomic Locus chr2:151410449
Transcript NM_018151
WT Expression Level 18.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 37bp insertion in a coding exon of RIF1.
Description 37bp insertion
Parental Cell Line C631
Guide RNA Sequence AGTCTCCAACAGCGGCGCGA
PCR Primer Forward: CTGGGGTTTGGTGATTCGGAG
Reverse: TCTAGAACTCACATTCATTCTACGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.