Rhoa cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Rhoa cDNA ORF Clone, Rat, untagged

Rhoa cDNA ORF Clone, Rat, untagged

SPD-13367

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat ras homolog family member A.
Target Information
Species Rat
Target Name RhoA
Gene Abbr. Rhoa
Gene ID 117273
Full Name ras homolog family member A
Alias Arha, Arha2
Introduction Rho family small GTPases, including Rho, Rac and cdc42, act as molecular switches, regulating processes such as cell migration, adhesion, proliferation and differentiation. They are activated by guanine nucleotide exchange factors (GEFs), which catalyze the exchange of bound GDP for GTP, and inhibited by GTPase activating proteins (GAPs), which catalyze the hydrolysis of GTP to GDP. A third level of regulation is provided by the stoichiometric binding of Rho GDP dissociation inhibitor (RhoGDI). RhoA, RhoB and RhoC are highly homologous, but appear to have divergent biological functions. Carboxy-terminal modifications and differences in subcellular localization allow these three proteins to respond to and act on distinct signaling molecules.Functions of RhoA, the most highly studied of these three, include regulation of actomyosin contractility, cytokinesis, focal adhesion assembly and cell polarity.
Product Details
Description Full length Clone DNA of Rat ras homolog family member A.
NCBI Ref Seq BC061732.1
RefSeq ORF Size 582 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.