Online Inquiry
RHOA cDNA ORF Clone, Canine, N-HA tag
SPD-13345
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine ras homolog family member A with N terminal HA tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | RhoA |
Gene Abbr. | RHOA |
Gene ID | 403954 |
Full Name | ras homolog family member A |
Introduction | Rho family small GTPases, including Rho, Rac and cdc42, act as molecular switches, regulating processes such as cell migration, adhesion, proliferation and differentiation. They are activated by guanine nucleotide exchange factors (GEFs), which catalyze the exchange of bound GDP for GTP, and inhibited by GTPase activating proteins (GAPs), which catalyze the hydrolysis of GTP to GDP. A third level of regulation is provided by the stoichiometric binding of Rho GDP dissociation inhibitor (RhoGDI). RhoA, RhoB and RhoC are highly homologous, but appear to have divergent biological functions. Carboxy-terminal modifications and differences in subcellular localization allow these three proteins to respond to and act on distinct signaling molecules.Functions of RhoA, the most highly studied of these three, include regulation of actomyosin contractility, cytokinesis, focal adhesion assembly and cell polarity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine ras homolog family member A with N terminal HA tag. |
NCBI Ref Seq | XM_005632310.1 |
RefSeq ORF Size | 582 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.