RHEB cDNA ORF Clone, Rhesus, C-Myc tag - CD BioSciences

service-banner

RHEB cDNA ORF Clone, Rhesus, C-Myc tag

RHEB cDNA ORF Clone, Rhesus, C-Myc tag

SPD-13298

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus Ras homolog enriched in brain with C terminal Myc tag.
Target Information
Species Rhesus
Target Name Rheb
Gene Abbr. RHEB
Gene ID 715378
Full Name Ras homolog, mTORC1 binding
Introduction Ras Homolog Enriched in Brain (Rheb) is an evolutionarily conserved member of the Ras family of small GTP-binding proteins originally found to be rapidly induced by synaptic activity in the hippocampus following seizure. While it is expressed at relatively high levels in the brain, Rheb is widely expressed in other tissues and may be induced by growth factor stimulation. Like other Ras family members, Rheb triggers activation of the Raf-MEK-MAPK pathway. Biochemical and genetic studies demonstrate that Rheb has an important role in regulating the insulin/TOR signaling pathway. The mammalian target of rapamycin (mTOR) is a serine/threonine protein kinase that acts as a sensor for ATP and amino acids, balancing the availability of nutrients with translation and cell growth. The tuberin/hamartin (TSC2/TSC1) complex inhibits mTOR activity indirectly by inhibiting Rheb through the tuberin GAP activity.
Product Details
Description Full length Clone DNA of Rhesus Ras homolog enriched in brain with C terminal Myc tag.
NCBI Ref Seq NM_001261182.1
RefSeq ORF Size 555 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.