Online Inquiry
RHEB cDNA ORF Clone, Human, C-HA tag
SPD-13309
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Ras homolog enriched in brain with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Rheb |
| Gene Abbr. | RHEB |
| Gene ID | 6009 |
| Full Name | Ras homolog, mTORC1 binding |
| Alias | RHEB2 |
| Introduction | Ras Homolog Enriched in Brain (Rheb) is an evolutionarily conserved member of the Ras family of small GTP-binding proteins originally found to be rapidly induced by synaptic activity in the hippocampus following seizure. While it is expressed at relatively high levels in the brain, Rheb is widely expressed in other tissues and may be induced by growth factor stimulation. Like other Ras family members, Rheb triggers activation of the Raf-MEK-MAPK pathway. Biochemical and genetic studies demonstrate that Rheb has an important role in regulating the insulin/TOR signaling pathway. The mammalian target of rapamycin (mTOR) is a serine/threonine protein kinase that acts as a sensor for ATP and amino acids, balancing the availability of nutrients with translation and cell growth. The tuberin/hamartin (TSC2/TSC1) complex inhibits mTOR activity indirectly by inhibiting Rheb through the tuberin GAP activity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Ras homolog enriched in brain with C terminal HA tag. |
| NCBI Ref Seq | NM_005614.3 |
| RefSeq ORF Size | 597 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 0.6kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.