RGS2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RGS2 cDNA ORF Clone, Human, untagged

RGS2 cDNA ORF Clone, Human, untagged

SPD-13274

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human regulator of G-protein signaling 2, 24kDA.
Target Information
Species Human
Target Name RGS2
Gene Abbr. RGS2
Gene ID 5997
Full Name regulator of G protein signaling 2
Alias G0S8
Product Details
Description Full length Clone DNA of Human regulator of G-protein signaling 2, 24kDA.
NCBI Ref Seq BC007049
RefSeq ORF Size 636 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.