Rgs19 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Rgs19 cDNA ORF Clone, Mouse, untagged

Rgs19 cDNA ORF Clone, Mouse, untagged

SPD-13263

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse regulator of G-protein signaling 19.
Target Information
Species Mouse
Target Name RGS19
Gene Abbr. Rgs19
Gene ID 56470
Full Name regulator of G-protein signaling 19
Alias 2610042F04Rik, AI324841, AW547781, GAIP
Product Details
Description Full length Clone DNA of Mouse regulator of G-protein signaling 19.
NCBI Ref Seq XM_006500684.1
RefSeq ORF Size 651 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.