RETREG1 Knockout Cell Line - CD BioSciences

service-banner

RETREG1 Knockout Cell Line

RETREG1 Knockout Cell Line

SPL-03004

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name RETREG1
Gene Abbr. RETREG1
Gene ID 54463
Full Name reticulophagy regulator 1
Alias FAM134B, JK-1, JK1
Species Human
Genomic Locus chr5:16481014
Transcript NM_019000
WT Expression Level 10.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of FAM134B.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence AGATAGCTGAGTATAACCCC
PCR Primer Forward: AAATGGAGAAACTTTGTACAGCAGG
Reverse: TTACAATTGTGTGTGTATCCTGTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.