Online Inquiry
RERE Knockout Cell Line
SPL-02998
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp deletion |
Target Information | |
---|---|
Target Name | RERE |
Gene Abbr. | RERE |
Gene ID | 473 |
Full Name | arginine-glutamic acid dipeptide repeats |
Alias | ARG, ARP, ATN1L, DNB1, NEDBEH |
Species | Human |
Genomic Locus | chr1:8362755 |
Transcript | NM_001042681 |
WT Expression Level | 34.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of RERE. |
Description | 1bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AAGACATCCGCTCCAGCGGC |
PCR Primer |
Forward: CACGAATACCAGCAAACCAGTTTTA Reverse: GATTTGCTGAGAGGCTGATAGGG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.