Online Inquiry
RER1 Knockout Cell Line
SPL-02996
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 118bp insertion |
| Target Information | |
|---|---|
| Target Name | RER1 |
| Gene Abbr. | RER1 |
| Gene ID | 11079 |
| Full Name | retention in endoplasmic reticulum sorting receptor 1 |
| Species | Human |
| Genomic Locus | chr1:2397144 |
| Transcript | NM_007033 |
| WT Expression Level | 122.80 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a multi-pass membrane protein that is localized to the golgi apparatus. It is involved in the retention of endoplasmic reticulum (ER) membrane proteins in the ER and retrieval of ER membrane proteins from the early Golgi compartment to facilitate gamma-secretase complex assembly. [provided by RefSeq, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 118bp insertion in a coding exon of RER1. |
| Description | 118bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACCCTACACGGCTGTGCGA |
| PCR Primer |
Forward: AGAGATGAACCTGCTTCAGGAATTA Reverse: CAAGACAGACTGGATCAACAACATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.