Online Inquiry
RELA Knockout Cell Line
SPL-02994
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | NF-κB |
| Gene Abbr. | RELA |
| Gene ID | 5970 |
| Full Name | RELA proto-oncogene, NF-kB subunit |
| Alias | CMCU, NFKB3, p65 |
| Species | Human |
| Genomic Locus | chr11:65661741 |
| Transcript | NM_021975 |
| WT Expression Level | 78.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of RELA. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCCTTTCCTACAAGCTCGTG |
| PCR Primer |
Forward: CCTGGAACTCATCTGCTAGAGTAAA Reverse: CTCTGTGTTTGGGAGTCAGGTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.