Online Inquiry
Rela cDNA ORF Clone, Mouse, C-Myc tag
SPD-10684
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | NF-κB |
Gene Abbr. | Rela |
Gene ID | 19697 |
Full Name | v-rel reticuloendotheliosis viral oncogene homolog A (avian) |
Alias | p6, p65, p65 NF-kappa B, p65 NFkB |
Introduction | Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.NF-κB assembly with IκB, as well as its DNA binding and transcriptional activity, are regulated by p300/CBP acetytransferases that principally target Lys218, Lys221 and Lys310. This process is reciprocally regulated by histone deacetylases (HDACs); several HDAC inhibitors have been shown to activate NF-κB. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal Myc tag. |
NCBI Ref Seq | NM_009045.4 |
RefSeq ORF Size | 1650 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.