RELA cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

RELA cDNA ORF Clone, Human, C-HA tag

RELA cDNA ORF Clone, Human, C-HA tag

SPD-10675

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal HA tag.
Target Information
Species Human
Target Name NF-κB
Gene Abbr. RELA
Gene ID 5970
Full Name RELA proto-oncogene, NF-kB subunit
Alias CMCU, NFKB3, p65
Introduction Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.NF-κB assembly with IκB, as well as its DNA binding and transcriptional activity, are regulated by p300/CBP acetytransferases that principally target Lys218, Lys221 and Lys310. This process is reciprocally regulated by histone deacetylases (HDACs); several HDAC inhibitors have been shown to activate NF-κB.
Product Details
Description Full length Clone DNA of Human v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal HA tag.
NCBI Ref Seq NM_021975
RefSeq ORF Size 1656 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.71kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.