REL cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

REL cDNA ORF Clone, Human, C-Myc tag

REL cDNA ORF Clone, Human, C-Myc tag

SPD-10664

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-rel reticuloendotheliosis viral oncogene homolog (avian) with C terminal Myc tag.
Target Information
Species Human
Target Name NF-κB
Gene Abbr. REL
Gene ID 5966
Full Name REL proto-oncogene, NF-kB subunit
Alias C-Rel
Introduction Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.
Product Details
Description Full length Clone DNA of Human v-rel reticuloendotheliosis viral oncogene homolog (avian) with C terminal Myc tag.
NCBI Ref Seq BC117191
RefSeq ORF Size 1764 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.