RECQL4 Knockout Cell Line - CD BioSciences

service-banner

RECQL4 Knockout Cell Line

RECQL4 Knockout Cell Line

SPL-02990

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name RECQL4
Gene Abbr. RECQL4
Gene ID 9401
Full Name RecQ like helicase 4
Alias RECQ4
Species Human
Genomic Locus chr8:144517075
Transcript NM_004260
WT Expression Level 92.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of RECQL4.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TTGAGCCGCTGCCCGTAGTC
PCR Primer Forward: CTAATTAGCACAAGGCTGGACTAGA
Reverse: AACAGCCTTTTCTGGCCTGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.