Rbpj cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Rbpj cDNA ORF Clone, Mouse, N-HA tag

Rbpj cDNA ORF Clone, Mouse, N-HA tag

SPD-13139

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse recombination signal binding protein for immunoglobulin kappa J region with N terminal HA tag.
Target Information
Species Mouse
Target Name RBPSUH
Gene Abbr. Rbpj
Gene ID 19664
Full Name recombination signal binding protein for immunoglobulin kappa J region
Alias AI843960, CBF1, Igk, Igkj, Igkjrb
Introduction RBPSUH (Recombining Binding Protein, SUppressor of Hairless), also termed RBP-J or CSL, is the DNA-binding component of the transcription complex regulated by canonical Notch signaling. In the absence of Notch activation, RBPSUH suppresses target gene expression through interactions with a co-repressor complex containing histone deacetylase. Upon activation of Notch receptors, the Notch intracellular domain (NICD) translocates to the nucleus and binds to RBPSUH. This displaces the co-repressor complex and replaces it with a transcription activation complex that includes Mastermind-like (MAML) proteins and histone acetylase p300, leading to transcriptional activation of Notch target genes. RBPSUH is also the DNA-binding partner for Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA2), a protein critical for latent viral transcription and immortalization of EBV-infected B cells.
Product Details
Description Full length Clone DNA of Mouse recombination signal binding protein for immunoglobulin kappa J region with N terminal HA tag.
NCBI Ref Seq NM_001277116.1
RefSeq ORF Size 1524 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.