Online Inquiry
RBPJ cDNA ORF Clone, Human, C-Myc tag
SPD-13153
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human recombination signal binding protein for immunoglobulin kappa J region with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | RBPSUH |
| Gene Abbr. | RBPJ |
| Gene ID | 3516 |
| Full Name | recombination signal binding protein for immunoglobulin kappa J region |
| Alias | AOS3, CBF-1, CBF1, IGKJRB, IGKJRB1 |
| Introduction | RBPSUH (Recombining Binding Protein, SUppressor of Hairless), also termed RBP-J or CSL, is the DNA-binding component of the transcription complex regulated by canonical Notch signaling. In the absence of Notch activation, RBPSUH suppresses target gene expression through interactions with a co-repressor complex containing histone deacetylase. Upon activation of Notch receptors, the Notch intracellular domain (NICD) translocates to the nucleus and binds to RBPSUH. This displaces the co-repressor complex and replaces it with a transcription activation complex that includes Mastermind-like (MAML) proteins and histone acetylase p300, leading to transcriptional activation of Notch target genes. RBPSUH is also the DNA-binding partner for Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA2), a protein critical for latent viral transcription and immortalization of EBV-infected B cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human recombination signal binding protein for immunoglobulin kappa J region with C terminal Myc tag. |
| NCBI Ref Seq | BC020780 |
| RefSeq ORF Size | 1503 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 1.50kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.