RB1 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

RB1 cDNA ORF Clone, Human, N-Myc tag

RB1 cDNA ORF Clone, Human, N-Myc tag

SPD-13126

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human retinoblastoma 1 with N terminal Myc tag.
Target Information
Species Human
Target Name Rb
Gene Abbr. RB1
Gene ID 5925
Full Name RB transcriptional corepressor 1
Alias OSRC, PPP1R130, RB, p105-Rb, p110-RB1
Introduction The retinoblastoma tumor suppressor protein Rb regulates cell proliferation by controlling progression through the restriction point within the G1-phase of the cell cycle. Rb has three functionally distinct binding domains and interacts with critical regulatory proteins including the E2F family of transcription factors, c-Abl tyrosine kinase, and proteins with a conserved LXCXE motif. Cell cycle-dependent phosphorylation by a CDK inhibits Rb target binding and allows cell cycle progression. Rb inactivation and subsequent cell cycle progression likely requires an initial phosphorylation by cyclin D-CDK4/6 followed by cyclin E-CDK2 phosphorylation. Specificity of different CDK/cyclin complexes has been observed in vitro and cyclin D1 is required for Ser780 phosphorylation in vivo.
Product Details
Description Full length Clone DNA of Human retinoblastoma 1 with N terminal Myc tag.
NCBI Ref Seq NM_000321.2
RefSeq ORF Size 2787 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.