Online Inquiry
RB1 cDNA ORF Clone, Human, N-His tag
SPD-13125
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human retinoblastoma 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Rb |
Gene Abbr. | RB1 |
Gene ID | 5925 |
Full Name | RB transcriptional corepressor 1 |
Alias | OSRC, PPP1R130, RB, p105-Rb, p110-RB1 |
Introduction | The retinoblastoma tumor suppressor protein Rb regulates cell proliferation by controlling progression through the restriction point within the G1-phase of the cell cycle. Rb has three functionally distinct binding domains and interacts with critical regulatory proteins including the E2F family of transcription factors, c-Abl tyrosine kinase, and proteins with a conserved LXCXE motif. Cell cycle-dependent phosphorylation by a CDK inhibits Rb target binding and allows cell cycle progression. Rb inactivation and subsequent cell cycle progression likely requires an initial phosphorylation by cyclin D-CDK4/6 followed by cyclin E-CDK2 phosphorylation. Specificity of different CDK/cyclin complexes has been observed in vitro and cyclin D1 is required for Ser780 phosphorylation in vivo. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human retinoblastoma 1 with N terminal His tag. |
NCBI Ref Seq | NM_000321.2 |
RefSeq ORF Size | 2787 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.