RASSF5 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RASSF5 cDNA ORF Clone, Human, untagged

RASSF5 cDNA ORF Clone, Human, untagged

SPD-13108

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Ras association (RalGDS/AF-6) domain family member 5.
Target Information
Species Human
Target Name RASSF5
Gene Abbr. RASSF5
Gene ID 83593
Full Name Ras association domain family member 5
Alias Maxp1, NORE1, NORE1A, NORE1B, RAPL
Product Details
Description Full length Clone DNA of Human Ras association (RalGDS/AF-6) domain family member 5.
NCBI Ref Seq BC042651
RefSeq ORF Size 798 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.