RASGRF1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RASGRF1 cDNA ORF Clone, Human, untagged

RASGRF1 cDNA ORF Clone, Human, untagged

SPD-13088

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Ras protein-specific guanine nucleotide-releasing factor 1.
Target Information
Species Human
Target Name RASGRF1
Gene Abbr. RASGRF1
Gene ID 5923
Full Name Ras protein specific guanine nucleotide releasing factor 1
Alias CDC25, CDC25L, GNRP, GRF1, GRF55
Product Details
Description Full length Clone DNA of Human Ras protein-specific guanine nucleotide-releasing factor 1.
NCBI Ref Seq BC040275
RefSeq ORF Size 3546 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 3.55kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.