RARA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RARA cDNA ORF Clone, Human, untagged

RARA cDNA ORF Clone, Human, untagged

SPD-13057

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human retinoic acid receptor, alpha, transcript variant 1.
Target Information
Species Human
Target Name RARA
Gene Abbr. RARA
Gene ID 5914
Full Name retinoic acid receptor alpha
Alias NR1B1, RAR
Product Details
Description Full length Clone DNA of Human retinoic acid receptor, alpha, transcript variant 1.
NCBI Ref Seq NM_000964.2
RefSeq ORF Size 1389 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.39kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.