RAP1B cDNA ORF Clone, Ferret, C-FLAG tag - CD BioSciences

service-banner

RAP1B cDNA ORF Clone, Ferret, C-FLAG tag

RAP1B cDNA ORF Clone, Ferret, C-FLAG tag

SPD-13027

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Ferret RAP1B, member of RAS oncogene family with C terminal Flag tag.
Target Information
Species Ferret
Target Name Rap1B
Gene Abbr. RAP1B
Gene ID 101691404
Full Name RAP1B, member of RAS oncogene family
Introduction Rap1 and Rap2 belong to the Ras subfamily of small GTPases and are activated by a wide variety of stimuli through integrins, receptor tyrosine kinases (RTKs), G-protein coupled receptors (GPCR), death domain associated receptors (DD-R) and ion channels. Like other small GTPases, Rap activity is stimulated by guanine nucleotide exchange factors (GEF) and inactivated by GTPase activating proteins (GAP). A wide variety of Rap GEFs have been identified: C3G connects Rap1 with RTKs through adaptor proteins such as Crk, Epacs (or cAMP-GEFs) transmit signals from cAMP, and CD-GEFs (or CalDAG-GEFs) convey signals from either or both Ca2+ and DAG. Rap1 primarily regulates multiple integrin-dependent processes such as morphogenesis, cell-cell adhesion, hematopoiesis, leukocyte migration and tumor invasion. Rap1 may also regulate proliferation, differentiation and survival through downstream effectors including B-Raf, PI3K, RalGEF and phospholipases (PLCs). Rap1 and Rap2 are not fuctionally redundant as they perform overlapping but distinct functions. Recent research indicates that Rap2 regulates Dsh subcellular localization and is required for Wnt signaling in early development.
Product Details
Description Full length Clone DNA of Ferret RAP1B, member of RAS oncogene family with C terminal Flag tag.
NCBI Ref Seq XM_004752461.1
RefSeq ORF Size 555 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.