Online Inquiry
Rap1a cDNA ORF Clone, Mouse, N-Myc tag
SPD-13012
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse RAS-related protein-1a with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Rap1A |
Gene Abbr. | Rap1a |
Gene ID | 109905 |
Full Name | RAS-related protein 1a |
Alias | AI848598, G-22K, Krev, Krev-1, R |
Introduction | Rap1 and Rap2 belong to the Ras subfamily of small GTPases and are activated by a wide variety of stimuli through integrins, receptor tyrosine kinases (RTKs), G-protein coupled receptors (GPCR), death domain associated receptors (DD-R) and ion channels. Like other small GTPases, Rap activity is stimulated by guanine nucleotide exchange factors (GEF) and inactivated by GTPase activating proteins (GAP). A wide variety of Rap GEFs have been identified: C3G connects Rap1 with RTKs through adaptor proteins such as Crk, Epacs (or cAMP-GEFs) transmit signals from cAMP, and CD-GEFs (or CalDAG-GEFs) convey signals from either or both Ca2+ and DAG. Rap1 primarily regulates multiple integrin-dependent processes such as morphogenesis, cell-cell adhesion, hematopoiesis, leukocyte migration and tumor invasion. Rap1 may also regulate proliferation, differentiation and survival through downstream effectors including B-Raf, PI3K, RalGEF and phospholipases (PLCs). Rap1 and Rap2 are not fuctionally redundant as they perform overlapping but distinct functions. Recent research indicates that Rap2 regulates Dsh subcellular localization and is required for Wnt signaling in early development. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse RAS-related protein-1a with N terminal Myc tag. |
NCBI Ref Seq | NM_145541.5 |
RefSeq ORF Size | 555 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.