RAP1A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RAP1A cDNA ORF Clone, Human, untagged

RAP1A cDNA ORF Clone, Human, untagged

SPD-13015

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human RAP1A, member of RAS oncogene family
Target Information
Species Human
Target Name Rap1A
Gene Abbr. RAP1A
Gene ID 5906
Full Name RAP1A, member of RAS oncogene family
Alias C21KG, G-22K, KREV-1, KREV1, RAP1
Introduction Rap1 and Rap2 belong to the Ras subfamily of small GTPases and are activated by a wide variety of stimuli through integrins, receptor tyrosine kinases (RTKs), G-protein coupled receptors (GPCR), death domain associated receptors (DD-R) and ion channels. Like other small GTPases, Rap activity is stimulated by guanine nucleotide exchange factors (GEF) and inactivated by GTPase activating proteins (GAP). A wide variety of Rap GEFs have been identified: C3G connects Rap1 with RTKs through adaptor proteins such as Crk, Epacs (or cAMP-GEFs) transmit signals from cAMP, and CD-GEFs (or CalDAG-GEFs) convey signals from either or both Ca2+ and DAG. Rap1 primarily regulates multiple integrin-dependent processes such as morphogenesis, cell-cell adhesion, hematopoiesis, leukocyte migration and tumor invasion. Rap1 may also regulate proliferation, differentiation and survival through downstream effectors including B-Raf, PI3K, RalGEF and phospholipases (PLCs). Rap1 and Rap2 are not fuctionally redundant as they perform overlapping but distinct functions. Recent research indicates that Rap2 regulates Dsh subcellular localization and is required for Wnt signaling in early development.
Product Details
Description Full length Clone DNA of Human RAP1A, member of RAS oncogene family
NCBI Ref Seq NM_001010935.2
RefSeq ORF Size 555 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.56kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.