Online Inquiry
RAMP1 Knockout Cell Line
SPL-02962
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | RAMP1 |
Gene Abbr. | RAMP1 |
Gene ID | 10267 |
Full Name | receptor activity modifying protein 1 |
Species | Human |
Genomic Locus | chr2:237877304 |
Transcript | NM_005855 |
WT Expression Level | 18.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of RAMP1. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CAGGTAGACATGGAGGCCGT |
PCR Primer |
Forward: CCTCTCCAGGGGTTGCTTAGAG Reverse: TCTAGAAAGGATCTTCCACAGCTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.