Online Inquiry
RAF1 Knockout Cell Line
SPL-02955
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | c-Raf |
Gene Abbr. | RAF1 |
Gene ID | 5894 |
Full Name | Raf-1 proto-oncogene, serine/threonine kinase |
Alias | CMD1NN, CRAF, NS5, Raf-1, c-Raf |
Species | Human |
Genomic Locus | chr3:12618601 |
Transcript | NM_002880 |
WT Expression Level | 66.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of RAF1. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCAGTTTGGCTATCAGCGCC |
PCR Primer |
Forward: TGTAAAACGACGGCCAGTGCTGATGAATGCAGGAGGT Reverse: TAGGGGGTGTGGAAGGAACA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.