Online Inquiry
RAD52 Knockout Cell Line
SPL-02951
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | RAD52 |
| Gene Abbr. | RAD52 |
| Gene ID | 5893 |
| Full Name | RAD52 homolog, DNA repair protein |
| Species | Human |
| Genomic Locus | chr12:931236 |
| Transcript | NM_134424 |
| WT Expression Level | 10.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of RAD52. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACATAAGTAGCCGCATGGC |
| PCR Primer |
Forward: TGATGTAAAAATCTTAAGACGGCGG Reverse: ATGGAGACTCAATGATGTGAGGAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.