Rack1 cDNA ORF Clone, Rat, N-FLAG tag - CD BioSciences

service-banner

Rack1 cDNA ORF Clone, Rat, N-FLAG tag

Rack1 cDNA ORF Clone, Rat, N-FLAG tag

SPD-12967

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with N terminal Flag tag.
Target Information
Species Rat
Target Name RACK1
Gene Abbr. Rack1
Gene ID 83427
Full Name receptor for activated C kinase 1
Alias Gnb2l1
Introduction The highly conserved receptor for activated C kinase 1 (RACK1), homologous to the β subunit of heterotrimeric G-proteins, was originally identified through its binding of active PKCβII and other classical PKC isoforms. RACK1 is a scaffold protein that recruits PKC and a wide range of other proteins to specific subcellular locations, promoting the formation of multiprotein complexes to induce and integrate various signaling pathways. One example of this is its enhancement of PKC-dependent JNK activation. RACK1 protein also resides in the eukaryotic ribosome, suggesting the possibility that RACK1 participates in the assembly of signaling complexes that regulate translation as well. RACK1 binds the SH2 domain of Src, and phosphorylation of RACK1 by Src occurs at Tyr228 after PKC activation.
Product Details
Description Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with N terminal Flag tag.
NCBI Ref Seq NM_130734.2
RefSeq ORF Size 954 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.