Online Inquiry
RACK1 cDNA ORF Clone, Human, N-FLAG tag
SPD-12988
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | RACK1 |
| Gene Abbr. | RACK1 |
| Gene ID | 10399 |
| Full Name | receptor for activated C kinase 1 |
| Alias | GNB2L1, Gnb2-rs1, H12.3, HLC-7, PIG21 |
| Introduction | The highly conserved receptor for activated C kinase 1 (RACK1), homologous to the β subunit of heterotrimeric G-proteins, was originally identified through its binding of active PKCβII and other classical PKC isoforms. RACK1 is a scaffold protein that recruits PKC and a wide range of other proteins to specific subcellular locations, promoting the formation of multiprotein complexes to induce and integrate various signaling pathways. One example of this is its enhancement of PKC-dependent JNK activation. RACK1 protein also resides in the eukaryotic ribosome, suggesting the possibility that RACK1 participates in the assembly of signaling complexes that regulate translation as well. RACK1 binds the SH2 domain of Src, and phosphorylation of RACK1 by Src occurs at Tyr228 after PKC activation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 with N terminal Flag tag. |
| NCBI Ref Seq | BC019362.1 |
| RefSeq ORF Size | 993 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 0.99kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.