RAC2 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

RAC2 cDNA ORF Clone, Human, N-FLAG tag

RAC2 cDNA ORF Clone, Human, N-FLAG tag

SPD-12947

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) with N terminal Flag tag.
Target Information
Species Human
Target Name Rac
Gene Abbr. RAC2
Gene ID 5880
Full Name Rac family small GTPase 2
Alias EN-7, Gx, HSPC022, IMD73A, IMD73B
Introduction Rac and Cdc42 are members of the Rho-GTPase family. In mammals, Rac exists as three isoforms, Rac1, Rac2 and Rac3, which are highly similar in sequence. Rac1 and Cdc42, the most widely studied of this group, are ubiquitously expressed. Rac2 is expressed in cells of hematopoietic origin, and Rac3, while highly expressed in brain, is also found in many other tissues. Rac and Cdc42 play key signaling roles in cytoskeletal reorganization, membrane trafficking, transcriptional regulation, cell growth and development. GTP binding stimulates the activity of Rac/Cdc42, and the hydrolysis of GTP to GDP through the protein's intrinsic GTPase activity, rendering it inactive. GTP hydrolysis is aided by GTPase activating proteins (GAPs), while exchange of GDP for GTP is facilitated by guanine nucleotide exchange factors (GEFs). Another level of regulation is achieved through the binding of RhoGDI, a guanine nucleotide dissociation inhibitor, which retains Rho family GTPases, including Rac and Cdc42, in their inactive GDP-bound state.
Product Details
Description Full length Clone DNA of Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) with N terminal Flag tag.
NCBI Ref Seq NM_002872.3
RefSeq ORF Size 618 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 516T/C not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.62kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.