Online Inquiry
RAC1 cDNA ORF Clone, Human, N-Myc tag
SPD-12919
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), transcript variant Rac1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Rac |
Gene Abbr. | RAC1 |
Gene ID | 5879 |
Full Name | Rac family small GTPase 1 |
Alias | MIG5, MRD48, Rac-1, TC-25, p21-Rac1 |
Introduction | Rac and Cdc42 are members of the Rho-GTPase family. In mammals, Rac exists as three isoforms, Rac1, Rac2 and Rac3, which are highly similar in sequence. Rac1 and Cdc42, the most widely studied of this group, are ubiquitously expressed. Rac2 is expressed in cells of hematopoietic origin, and Rac3, while highly expressed in brain, is also found in many other tissues. Rac and Cdc42 play key signaling roles in cytoskeletal reorganization, membrane trafficking, transcriptional regulation, cell growth and development. GTP binding stimulates the activity of Rac/Cdc42, and the hydrolysis of GTP to GDP through the protein's intrinsic GTPase activity, rendering it inactive. GTP hydrolysis is aided by GTPase activating proteins (GAPs), while exchange of GDP for GTP is facilitated by guanine nucleotide exchange factors (GEFs). Another level of regulation is achieved through the binding of RhoGDI, a guanine nucleotide dissociation inhibitor, which retains Rho family GTPases, including Rac and Cdc42, in their inactive GDP-bound state. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), transcript variant Rac1 with N terminal Myc tag. |
NCBI Ref Seq | NM_006908.4 |
RefSeq ORF Size | 579 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.