RAB8A Knockout Cell Line - CD BioSciences

service-banner

RAB8A Knockout Cell Line

RAB8A Knockout Cell Line

SPL-02945

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name RAB8A
Gene Abbr. RAB8A
Gene ID 4218
Full Name RAB8A, member RAS oncogene family
Alias MEL, RAB8
Species Human
Genomic Locus chr19:16118240
Transcript NM_005370
WT Expression Level 72.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of RAB8A.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence ATTAGGACCATAGAGCTCGA
PCR Primer Forward: TGGAGAGGGAAAATATCTCCAAGTG
Reverse: CAAGAAATGGAGGCCAAGGTCAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.