Online Inquiry
RAB7A Knockout Cell Line
SPL-02944
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB7A |
| Gene Abbr. | RAB7A |
| Gene ID | 7879 |
| Full Name | RAB7A, member RAS oncogene family |
| Alias | CMT2B, PRO2706, RAB7 |
| Species | Human |
| Genomic Locus | chr3:128798008 |
| Transcript | NM_004637 |
| WT Expression Level | 629.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of RAB7A. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGAAAGTCAGCTCCTATTG |
| PCR Primer |
Forward: GCTAAATAGCAGCCACTAAATGGAG Reverse: GAACAGGGAAGGAAAATGTCTATGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.