RAB6A Knockout Cell Line - CD BioSciences

service-banner

RAB6A Knockout Cell Line

RAB6A Knockout Cell Line

SPL-02942

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name RAB6A
Gene Abbr. RAB6A
Gene ID 5870
Full Name RAB6A, member RAS oncogene family
Alias RAB6
Species Human
Genomic Locus chr11:73730780
Transcript NM_198896
WT Expression Level 73.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of RAB6A.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence AAAACTGTCATACATGAATC
PCR Primer Forward: AGGACTGGACAAAATCATTTACACA
Reverse: GTCATTTTGACAATCTTGGGGCTAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.