Online Inquiry
RAB4A Knockout Cell Line
SPL-02938
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB4A |
| Gene Abbr. | RAB4A |
| Gene ID | 5867 |
| Full Name | RAB4A, member RAS oncogene family |
| Alias | HRES-1, HRES-1/RAB4, HRES1, RAB4 |
| Species | Human |
| Genomic Locus | chr1:229286506 |
| Transcript | NM_004578 |
| WT Expression Level | 11.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of RAB4A. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTATTGGAAATGCAGGAAC |
| PCR Primer |
Forward: CCACTGAATTAACATGTCAGCCAAA Reverse: CTGTAAACAAATCTGAGTGAGAGGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.