RAB3A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RAB3A cDNA ORF Clone, Human, untagged

RAB3A cDNA ORF Clone, Human, untagged

SPD-12572

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human RAB3A, member RAS oncogene family
Target Information
Species Human
Target Name RAB3A
Gene Abbr. RAB3A
Gene ID 5864
Full Name RAB3A, member RAS oncogene family
Product Details
Description Full length Clone DNA of Human RAB3A, member RAS oncogene family
NCBI Ref Seq NM_002866.4
RefSeq ORF Size 663 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.