RAB32 Knockout Cell Line - CD BioSciences

service-banner

RAB32 Knockout Cell Line

RAB32 Knockout Cell Line

SPL-02933

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name RAB32
Gene Abbr. RAB32
Gene ID 10981
Full Name RAB32, member RAS oncogene family
Species Human
Genomic Locus chr6:146549633
Transcript NM_006834
WT Expression Level 4.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene anchors the type II regulatory subunit of protein kinase A to the mitochondrion and aids in mitochondrial fission. The encoded protein also appears to be involved in autophagy and melanosome secretion. Variations in this gene may be linked to leprosy. [provided by RefSeq, Dec 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of RAB32.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GGTCACATTTGTTAGCCAAG
PCR Primer Forward: CTGTTGGTGCTTTTGTAGTCTTTGA
Reverse: TAACACATCCATGCTACACTTCTCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.