Online Inquiry
RAB2A Knockout Cell Line
SPL-02928
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB2A |
| Gene Abbr. | RAB2A |
| Gene ID | 5862 |
| Full Name | RAB2A, member RAS oncogene family |
| Alias | LHX, RAB2 |
| Species | Human |
| Genomic Locus | chr8:60572060 |
| Transcript | NM_002865 |
| WT Expression Level | 124.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of RAB2A. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTCGAATGATAACTATTGA |
| PCR Primer |
Forward: ATAGCTAGTGGCAGATTTGGAGATT Reverse: GTGTCTAACAAACCATAACAGGCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.