RAB27A Knockout Cell Line - CD BioSciences

service-banner

RAB27A Knockout Cell Line

RAB27A Knockout Cell Line

SPL-02924

Size Price
1 Unit Online Inquiry
Description
19bp deletion
Target Information
Target Name RAB27A
Gene Abbr. RAB27A
Gene ID 5873
Full Name RAB27A, member RAS oncogene family
Alias GS2, HsT18676, RAB27, RAM
Species Human
Genomic Locus chr15:55230454
Transcript NM_183235
WT Expression Level 15.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and may be involved in protein transport and small GTPase mediated signal transduction. Mutations in this gene are associated with Griscelli syndrome type 2. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of RAB27A.
Description 19bp deletion
Parental Cell Line C631
Guide RNA Sequence AGTGGCTCCATCCGGCCCAC
PCR Primer Forward: ATAACCTCTCCCTTGACCTTGTATG
Reverse: TAGATGCCTTTGGGATTTGTACTGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.