RAB21 Knockout Cell Line - CD BioSciences

service-banner

RAB21 Knockout Cell Line

RAB21 Knockout Cell Line

SPL-02922

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name RAB21
Gene Abbr. RAB21
Gene ID 23011
Full Name RAB21, member RAS oncogene family
Species Human
Genomic Locus chr12:71769837
Transcript NM_014999
WT Expression Level 5.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene belongs to the Rab family of monomeric GTPases, which are involved in the control of cellular membrane traffic. The encoded protein plays a role in the targeted trafficking of integrins via its association with integrin alpha tails. As a consequence, the encoded protein is involved in the regulation of cell adhesion and migration. Expression of this gene is associated with a poor prognosis for glioma patients. This gene is downregulated by the tumor suppressor miR-200b, and miRNA-200b is itself downregulated in glioma tissues. [provided by RefSeq, Nov 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of RAB21.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence AAAGAGTAAACCTTGCCATA
PCR Primer Forward: GCTCTAGGGAAAATTTTGTTCCACAT
Reverse: AGAAGTATCTGCTGCATTATCCTCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.