Online Inquiry
RAB21 Knockout Cell Line
SPL-02922
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB21 |
| Gene Abbr. | RAB21 |
| Gene ID | 23011 |
| Full Name | RAB21, member RAS oncogene family |
| Species | Human |
| Genomic Locus | chr12:71769837 |
| Transcript | NM_014999 |
| WT Expression Level | 5.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to the Rab family of monomeric GTPases, which are involved in the control of cellular membrane traffic. The encoded protein plays a role in the targeted trafficking of integrins via its association with integrin alpha tails. As a consequence, the encoded protein is involved in the regulation of cell adhesion and migration. Expression of this gene is associated with a poor prognosis for glioma patients. This gene is downregulated by the tumor suppressor miR-200b, and miRNA-200b is itself downregulated in glioma tissues. [provided by RefSeq, Nov 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of RAB21. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGAGTAAACCTTGCCATA |
| PCR Primer |
Forward: GCTCTAGGGAAAATTTTGTTCCACAT Reverse: AGAAGTATCTGCTGCATTATCCTCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.