Online Inquiry
RAB1B Knockout Cell Line
SPL-02919
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB1B |
| Gene Abbr. | RAB1B |
| Gene ID | 81876 |
| Full Name | RAB1B, member RAS oncogene family |
| Species | Human |
| Genomic Locus | chr11:66272418 |
| Transcript | NM_030981 |
| WT Expression Level | 104.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Members of the RAB protein family, such as RAB1B, are low molecular mass monomeric GTPases localized on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB1B functions in the early secretory pathway and is essential for vesicle transport between the endoplasmic reticulum (ER) and Golgi (Chen et al., 1997 [PubMed 9030196]; Alvarez et al., 2003 [PubMed 12802079]).[supplied by OMIM, Jan 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of RAB1B. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGGGCTCATGGCATCATCG |
| PCR Primer |
Forward: CAAAATCCCCAGTACAGAGGTATCC Reverse: TCCTTGTGAAATGAGTCCAAGTACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.