RAB1B Knockout Cell Line - CD BioSciences

service-banner

RAB1B Knockout Cell Line

RAB1B Knockout Cell Line

SPL-02918

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name RAB1B
Gene Abbr. RAB1B
Gene ID 81876
Full Name RAB1B, member RAS oncogene family
Species Human
Genomic Locus chr11:66272418
Transcript NM_030981
WT Expression Level 104.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Members of the RAB protein family, such as RAB1B, are low molecular mass monomeric GTPases localized on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB1B functions in the early secretory pathway and is essential for vesicle transport between the endoplasmic reticulum (ER) and Golgi (Chen et al., 1997 [PubMed 9030196]; Alvarez et al., 2003 [PubMed 12802079]).[supplied by OMIM, Jan 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of RAB1B.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence GGGGGCTCATGGCATCATCG
PCR Primer Forward: CAAAATCCCCAGTACAGAGGTATCC
Reverse: TCCTTGTGAAATGAGTCCAAGTACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.