Rab1b cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Rab1b cDNA ORF Clone, Mouse, untagged

Rab1b cDNA ORF Clone, Mouse, untagged

SPD-12268

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse RAB1B, member RAS oncogene family.
Target Information
Species Mouse
Target Name RAB1B
Gene Abbr. Rab1b
Gene ID 76308
Full Name RAB1B, member RAS oncogene family
Alias 1110011F09Rik
Product Details
Description Full length Clone DNA of Mouse RAB1B, member RAS oncogene family.
NCBI Ref Seq NM_029576.3
RefSeq ORF Size 606 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.