Online Inquiry
RAB14 Knockout Cell Line
SPL-02917
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | RAB14 |
| Gene Abbr. | RAB14 |
| Gene ID | 51552 |
| Full Name | RAB14, member RAS oncogene family |
| Alias | FBP, RAB-14 |
| Species | Human |
| Genomic Locus | chr9:121190607 |
| Transcript | NM_016322 |
| WT Expression Level | 49.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of RAB14. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCGATTTAGGGCTGTTACA |
| PCR Primer |
Forward: AAACAAGTAAGTTCATTCACAGTCA Reverse: TAACAGTTATGGCTGATTGTCCTCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.