RAB14 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RAB14 cDNA ORF Clone, Human, untagged

RAB14 cDNA ORF Clone, Human, untagged

SPD-12167

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human RAB14, member RAS oncogene family.
Target Information
Species Human
Target Name RAB14
Gene Abbr. RAB14
Gene ID 51552
Full Name RAB14, member RAS oncogene family
Alias FBP, RAB-14
Product Details
Description Full length Clone DNA of Human RAB14, member RAS oncogene family.
NCBI Ref Seq BC006081
RefSeq ORF Size 648 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.