Online Inquiry
RAB13 Knockout Cell Line
SPL-02916
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | RAB13 |
| Gene Abbr. | RAB13 |
| Gene ID | 5872 |
| Full Name | RAB13, member RAS oncogene family |
| Alias | GIG4 |
| Species | Human |
| Genomic Locus | chr1:153983266 |
| Transcript | NM_002870 |
| WT Expression Level | 70.33 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of RAB13. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATCCGTGATGTCGTATACT |
| PCR Primer |
Forward: TTATGAATACAAAGGGTCAGGGGTT Reverse: TTAGGTCTTGCCTATCCTGATGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.